RosettaCommons - Nucleic Acids

Forums:

Rosetta 3 - General

Post Situation:

Number of Monte Carlo Cycles for FARFAR2

mandar — Wed, 13 Mar 2024 02:11:32 +0000

Hi,

I observed that the current default number of Monter Carlo cycles (-cycles option) for rna_denovo is 100000. If it is reduced to 20000, does it significantly affect the accuracy of the models built?

TIA,

Mandar

Category:

Forums:

Post Situation:

Deciding -nstruct for RNA FARFAR2

mandar — Fri, 08 Mar 2024 06:16:37 +0000

Hi,

I want to run FARFAR2 MPI protocol to build 3D model of 70 nt long RNA with command:

mpiexec -np 8 ${rna_denovo_mpi} -fasta seq.fasta -secstruct_file rna.secstruct -minimize_rna true -cycles 20000 -nstruct 5000 -fragment_homology_rmsd 1.2 -exclusion_match_type MATCH_YR -out:file:silent $outfile_name  > out.log

I am looking for suggestion about two parts:

1. How to decide optimal value for nstruct? I understand it could depend on RNA length, is there any thumb rule to decide -nstruct option?

2. I also want to include "base pair steps" sampling option. Is it related to options "-fragment_homology_rmsd 1.2 -exclusion_match_type MATCH_YR", as they seem to originate from FARNA protocol. However, I could not find more information on these options.

Thanks,
Mandar

Category:

Forums:

Post Situation:

FARFAR2 Error With Secondary Structure File

bdh81 — Thu, 02 Nov 2023 16:01:39 +0000

Any help with the following error? Thank you

--------------------------------------------------------------------

[FILE]: src/core/pose/rna/RNA_SecStruct.cc
[LINE]: 139
[START_MESSAGE]
[ ERROR ] UtilityExitException
ERROR: Number of right brackets does not match left brackets

[END_MESSAGE]
[END_CRASH_REPORT]

Category:

Forums:

Rosetta 3 - General

Post Situation:

ValueError("Path %s does not exist!" % path_name) for rna_helix.py

kameisel — Wed, 16 Aug 2023 07:39:57 +0000

Hi everyone,

I want to model helices with rna_helix.py but I get an error that rna_helix.linuxgccrelease isn't in the path where python script is looking for it:

File "/home/software/rosetta_bin_linux_2021.16.61629_bundle/main/tools/rna_tools/bin/rna_helix.py", line 27, in <module>

cmdline = rosetta_exe('rna_helix', rosetta_folder=args.rosetta_folder, extension=args.extension)

File "/home/software/rosetta_bin_linux_2021.16.61629_bundle/main/tools/rna_tools/bin/rosetta_exe.py", line 35, in rosetta_exe

check_path_exist(exe_path)

File "/home/software/rosetta_bin_linux_2021.16.61629_bundle/main/tools/rna_tools/bin/rosetta_exe.py", line 55, in check_path_exist

raise ValueError("Path %s does not exist!" % path_name)

ValueError: Path /home/software/rosetta_bin_linux_2021.16.61629_bundle/main/rna_helix.macosclangrelease

This ValueError regarding a MacOS version is due to the following line from rosetta_exe.py but also appears for the Linux Version by deleting the MacOS extensions:

name_extensions = ['', ".linuxgccrelease", ".linuxclangrelease", ".macosgccrelease", ".macosclangrelease"]

I found that rna_helix.linuxgccrelease is located in Path /home/software/rosetta_bin_linux_2021.16.61629_bundle/main/source/bin

when it should be in /home/software/rosetta_bin_linux_2021.16.61629_bundle/main

By using rna_helix.linuxgccrelease instead of rna_helix.py in bash it works and models a helix.

By running python rna_helix.py in bash I get:

File "/home/software/rosetta_bin_linux_2021.16.61629_bundle/main/tools/rna_tools/sym_link.py", line 22, in <module>

os.remove(f)

PermissionError: [Errno 13] Permission denied: './bin/rsync_from_cluster.py'

Feels like there's a problem with pathes in python script rosetta_exe.py and/or in the symbolic links in sym_link.py

Hopefully I was able to explain everything traceably and you can shed some light on this situation. Big thanks in advance!

Kind regards

Katherina

Category:

Structure prediction

Forums:

Post Situation:

Silent File Scores Missing: RNA Protein Complex Predition

axio23 — Fri, 16 Jun 2023 12:45:24 +0000

Dear Community,

I am relatively unexperienced with Rosetta and am for the first time trying to run the Protein RNA Complex Prediction Tutorial, as described on the website and the readme file using the latest weekly Ubuntu release. So apologies if I did a newcomer mistake.

When running as described, I get an error that I need to add the option base bair steps to false, so I added

-bps_moves false

Then it runs through. However, the scores reported in the silent file are missing the RNA and RNA interactions scoring energies as is the case in the example output file, and there is just one scoring term score which is then reported as zero. Strangely, in the terminal output it seems to report the RNA and RNA interaction scores correctly.

I attached with this post the output file I got with my run, the example output file and the the terminal output the run for 5 structure gives called out.

I would be grateful for any input.

Best wishes,

Attachment	Size
Output file of tutorial run, file extension switched from .out to txt	382.46 KB
Output file of example output files provided, file extension switched from .out to txt	384.54 KB
Output of Rosetta to terminal reporting scores	65.11 KB

Category:

Post Situation:

Forums:

ideal A-form RNA Helix

tspich — Wed, 17 May 2023 10:01:25 +0000

The tutorial (https://nbviewer.org/github/RosettaCommons/PyRosetta.notebooks/blob/master/notebooks/14.00-RNA-Basics.ipynb) claims that using:

assembler = core.import_pose.RNA_HelixAssembler()
helix_pose = assembler.build_init_pose('ggggggg','ccccccc')

should generate an ideal A-form RNA helix. However, the longest the sequence the closer the base pairs are coming together and a non relasitc helix is produced (see rna.png).

Am I missing something to get an ideal A-form RNA helix?

Attachment	Size
rna.png	119.76 KB

Category:

Post Situation:

Forums:

PyRosetta - Applications

Comparing a prediction to the native structure and calculate RMSD for RNA

danwolf_33 — Thu, 09 Feb 2023 17:32:46 +0000

Hi all,

I am new to Rosetta and FARFAR2. I have attempted modelling the structure of PDB:1KXK using the following command line:

rna_denovo -sequence gucuaccuaucgggcuaaggagccguaugcgaugaaagucgcacguacgguucuaugcccgggggaaaac -cycles 20000 -nstruct 3 -bps_moves false -minimize_rna true -secstruct ".....(((.((((((...(((((((((((((((....))))))..)))))))))..)))))))))....."

Now I want to compare the obtained structure to the original PDB and to calculate the RMSD. I ran the following:

rna_score -just_calc_rmsd -in:file:silent default.out -out:file:silent comparison.txt -native 1kxk.pdb

However I get the following error:

ERROR: Pose and native are different lengths. If you want, pass -dihedral_rms false
ERROR:: Exit from: src/apps/public/rna/util/rna_score.cc line: 226
protocols.jd2.JobDistributor: [ ERROR ]

[ERROR] Exception caught by JobDistributor for job S_000002_0001

[ ERROR ]: Caught exception:

File: src/apps/public/rna/util/rna_score.cc:226
[ ERROR ] UtilityExitException
ERROR: Pose and native are different lengths. If you want, pass -dihedral_rms false

If I add the "-dihedral_rms false" parameter the error seems to be gone, but I do not understand why and what does that parameter do. So, my questions:

1) Why does the output structure have 1 missing atom as compared to the native one (1496 vs. 1497)?
2) Why does adding the -dihedral_rms false parameter "solve"?
3) How can I generate a figure of the structures superimposed?
4) Is there a good manual/resource to refer to, to understand the meaning of the different parameters and analysis options of rna_denovo?

Thank you all for your kind help!

Best,

Daniel

Category:

Forums:

Post Situation:

FARFAR2 - Extra Minimize Hangs on Submittal

jvogt — Thu, 16 Jun 2022 16:41:10 +0000

Hello,

I have attempted several times to start a new FARFAR2 run that uses one or two template PDBs for homology modeling. This seems to work well with default settings, but I need to supply data in the "Residues for 'extra' minimization" text field to relax the homology model near its endpoints. When I include data in this field, it causes the popup "Submitting FARFAR2 job..." to display indefinitely. I waited overnight to see if this was just slowing things down quite a bit, but no success.

In terms of syntax of the text input, I am using the chain ID with a colon, the NT range without spaces and a single hyphen in the middle of the range. For example:

A:6-14

I tried this with and without quotation marks per the "format as" instructions on the job submit page.

Related feature request - it would be great to have the standalone RNA_minimize application available on the Rosie server.

Thank you for your help!

Category:

Forums:

ROSIE - General

Post Situation:

RNA update library

Anne Klein — Mon, 16 May 2022 23:04:21 +0000

Hi,

I'm building RNA structures of 4kb using rna_denovo. For some of my structures I have this error message:

ERROR: hey update AtomLevelDomainMap & RNA_ChunkLibrary to not use magic numbers like 999 and 1000

ERROR:: Exit from: src/core/import_pose/libraries/RNA_ChunkLibrary.cc line: 551

protocols.jd2.JobDistributor: [ ERROR ]

[ERROR] Exception caught by JobDistributor for job S_000001

[ ERROR ]: Caught exception:

File: src/core/import_pose/libraries/RNA_ChunkLibrary.cc:551

[ ERROR ] UtilityExitException

ERROR: hey update AtomLevelDomainMap & RNA_ChunkLibrary to not use magic numbers like 999 and 1000

The command line I'm running is:

rna_denovo.default.linuxgccrelease -fasta file.fa -secstruct_file file_struct -out:file:silent output_file.out -minimize_rna

Any idea of what could be causing this issue and how to solve it?

Many thanks :-)

Category:

Forums:

Rosetta 3 - General

Post Situation: