This historical page is locked! For new posts see Github Discussions.

You are here

rna_denovo secstruct_general function

1 post / 0 new
rna_denovo secstruct_general function
#1

Hello all, I had a question about how to properly use the -secstruct_general flag to input non-canonical and canonical basepairing interactions. I'm trying to test this on a simple structure from the 3IRW RNA that has a non-canonical g a basepair but I keep reseiving errors.  I am running the following command with the following files.

 

rna_denovo.static.linuxgccrelease -nstruct 1 -fasta ../test.fasta -secstruct_file ../test.secstruct -secstruct_general ../test.secgen -minimize_rna true -out:file:silent testing.out 

test.fasta: gcaaaccauucgaaagagugggacgc

test.secstruct: ((...((((((....))))))...))

test.secgen: ....(................)....

 

Using this setup I get the following error. 

 

ERROR: Length of sequence & secstruct do not match:    26    14
ERROR:: Exit from: src/core/pose/rna/RNA_SecStruct.cc line: 270

[ ERROR ]: Caught exception:


File: src/core/pose/rna/RNA_SecStruct.cc:270
[ ERROR ] UtilityExitException
ERROR: Length of sequence & secstruct do not match:    26    14

 

I entered the secstruct_general file based on my understanding of it from here. https://www.rosettacommons.org/docs/latest/application_documentation/rna/rna-denovo. I have also tried ((..[((((((....))))))]..)) for the -secstruct_general file but it also gives me the error. Any insight or advice would be very helpful, thank you.

Category: 
Post Situation: 
Mon, 2021-02-01 13:39
rvandamme