This historical page is locked! For new posts see Github Discussions.

You are here

connecting rna strands together

2 posts / 0 new
Last post
connecting rna strands together
#1

Hi there, could anyone please tell me how I can connect two rna strands together via a known linker  that I don't have a structure for ?

Supposedly: RNA 1 is uaugaaaaua

RNA2 is cggcgaaagccg

and their linker is uuu

making a total of :

uaugaaaauauuucggcgaaagccg

How can i do this via rna_denovo?

 

Thanks in advance for any help!

 

Category: 
Post Situation: 
Tue, 2021-11-09 05:42
y_atsmonraz

EDIT: resolved this with the tutorials, apparently all i needed to do was just fill in the full sequence into the input fasta while having the relevant fragments located in the input pdb and  the software did the rest for me

 

Thu, 2021-11-11 04:51
y_atsmonraz