This historical page is locked! For new posts see Github Discussions.

You are here

Comparing a prediction to the native structure and calculate RMSD for RNA

1 post / 0 new
Comparing a prediction to the native structure and calculate RMSD for RNA
#1

Hi all,

I am new to Rosetta and FARFAR2. I have attempted modelling the structure of PDB:1KXK using the following command line:

rna_denovo -sequence gucuaccuaucgggcuaaggagccguaugcgaugaaagucgcacguacgguucuaugcccgggggaaaac -cycles 20000 -nstruct 3 -bps_moves false -minimize_rna true -secstruct ".....(((.((((((...(((((((((((((((....))))))..)))))))))..)))))))))....."

Now I want to compare the obtained structure to the original PDB and to calculate the RMSD. I ran the following:

rna_score -just_calc_rmsd -in:file:silent default.out -out:file:silent comparison.txt -native 1kxk.pdb

However I get the following error:

ERROR: Pose and native are different lengths. If you want, pass -dihedral_rms false
ERROR:: Exit from: src/apps/public/rna/util/rna_score.cc line: 226
protocols.jd2.JobDistributor: [ ERROR ]

[ERROR] Exception caught by JobDistributor for job S_000002_0001

[ ERROR ]: Caught exception:


File: src/apps/public/rna/util/rna_score.cc:226
[ ERROR ] UtilityExitException
ERROR: Pose and native are different lengths. If you want, pass -dihedral_rms false

If I add the "-dihedral_rms false" parameter the error seems to be gone, but I do not understand why and what does that parameter do. So, my questions:

1) Why does the output structure have 1 missing atom as compared to the native one (1496 vs. 1497)?
2) Why does adding the -dihedral_rms false parameter "solve"?
3) How can I generate a figure of the structures superimposed?
4) Is there a good manual/resource to refer to, to understand the meaning of the different parameters and analysis options of rna_denovo?

Thank you all for your kind help!

Best,

Daniel

Category: 
Post Situation: 
Thu, 2023-02-09 09:32
danwolf_33