You are here

Structure prediction

FARFAR2 error: [ERROR: Not complementary at positions]

Category: 
Structure prediction

Any help with the following error from the rna_denovo function? Thank you

ERROR: Not complementary at positions g    4 and a   21
ERROR:: Exit from: src/core/pose/rna/RNA_SecStruct.cc line: 284

[ ERROR ]: Caught exception:


File: src/core/pose/rna/RNA_SecStruct.cc:284
[ ERROR ] UtilityExitException
ERROR: Not complementary at positions g    4 and a   21

====

my fasta file:

cgcgaauuagcgcgcgaauuagcg

 

the secondary structure file:

Post Situation: 

'Use_filters true' option - failure of AbInitio Relax application

Category: 
Structure prediction

Dear Rosetta community,

I would kindly ask you about possible reasons of AbInitio Relax failure after application of all filters.

It was decided to do an extensive run of AbRelax application with 'use_filters true' option to generate 1000 constructs (nstruct) in hope, that some of them will pass all filters and will have a nature-like fold structure.

I noticed, that when all 3 filters are applied during the construct trial, the AbRelax application fails with such an error:

Finished Abinitio

Post Situation: 

Predicting conformations of mutated residues

Category: 
Structure prediction

Hi all,

I am attempting to predict the conformations of an enzyme after a single mutation. I have been using pymol to place the mutation into the protein and then I use the rosetta relax application to optimize the structure. Is this a valid way of performing this technique? Or should I be using rosetta scripts and repack the sidechains instead. I am worried that the relax protocol may not be able to optimize the residue if pymol puts it in a conformation that is far away from the optimal conformation.

Thank you!

Post Situation: 

ValueError("Path %s does not exist!" % path_name) for rna_helix.py

Category: 
Structure prediction
Nucleic Acids

Hi everyone,

I want to model helices with rna_helix.py but I get an error that rna_helix.linuxgccrelease isn't in the path where python script is looking for it:

File "/home/software/rosetta_bin_linux_2021.16.61629_bundle/main/tools/rna_tools/bin/rna_helix.py", line 27, in <module>

Post Situation: 

Antibody Structure Prediction - Error on antibody_H3 step: "Option matching -antibody:remodel not found in command line"

Category: 
Structure prediction

I'm trying to predict the structure of an antibody by following this Rosetta Antibody Modelling tutorial: https://meilerlab.org/wp-content/uploads/2022/02/RosettaAntibody_tutorial.pdf

At the 5th step, during the refinement of the model, I find the following error:

Post Situation: 

rosetta_cm - ERROR: Assertion `tlen < slen` failed on File: src/core/fragment/util.cc:177

Category: 
Structure prediction

I'm following this tutorial to run a protein structure prediction: https://new.rosettacommons.org/demos/latest/tutorials/rosetta_cm/rosetta_cm_tutorial

I was able to model one protein sequence successfully following those steps, but trying for different ones I've been getting this same error:

Post Situation: 

fragment_picker:[ ERROR ] UtilityExitException ERROR: can't open file: $ROSETTA/tools/fragment_tools/vall.jul19.2011.gz

Category: 
Structure prediction

Hi,

When I run fragment_picker, it gives the message:

ERROR: can't open file: $ROSETTA/tools/fragment_tools/vall.jul19.2011.gz
ERROR:: Exit from: src/protocols/frag_picker/VallProvider.cc line: 17
 

the detail message as follows:

Post Situation: 

Pages