Academic Email Verification
Hello,
I would like my academic email to be validated. Institute: RadboudUMC and domain: @radboudumc.nl
Best,
Charbel
Hello,
I would like my academic email to be validated. Institute: RadboudUMC and domain: @radboudumc.nl
Best,
Charbel
Subject: Inquiry about MPI-Rosetta: Issue with -nstruct Parameter
Hello Rosetta community,
My name is Serena, and I have a question regarding the MPI-Rosetta forum. I hope to articulate my issue clearly.
Hi,
When I ran "pdb_renumber.py", I got the " ERROR: This script requires that Biopython (http://biopython.org) is installed." Acutally I installed Biopython. Is there any suggestion.
Thanks
Any help with the following error from the rna_denovo function? Thank you
ERROR: Not complementary at positions g 4 and a 21
ERROR:: Exit from: src/core/pose/rna/RNA_SecStruct.cc line: 284
[ ERROR ]: Caught exception:
File: src/core/pose/rna/RNA_SecStruct.cc:284
[ ERROR ] UtilityExitException
ERROR: Not complementary at positions g 4 and a 21
====
my fasta file:
cgcgaauuagcgcgcgaauuagcg
the secondary structure file:
Dear Rosetta community,
I would kindly ask you about possible reasons of AbInitio Relax failure after application of all filters.
It was decided to do an extensive run of AbRelax application with 'use_filters true' option to generate 1000 constructs (nstruct) in hope, that some of them will pass all filters and will have a nature-like fold structure.
I noticed, that when all 3 filters are applied during the construct trial, the AbRelax application fails with such an error:
Finished Abinitio
Hi all,
I am attempting to predict the conformations of an enzyme after a single mutation. I have been using pymol to place the mutation into the protein and then I use the rosetta relax application to optimize the structure. Is this a valid way of performing this technique? Or should I be using rosetta scripts and repack the sidechains instead. I am worried that the relax protocol may not be able to optimize the residue if pymol puts it in a conformation that is far away from the optimal conformation.
Thank you!
Hi everyone,
I want to model helices with rna_helix.py but I get an error that rna_helix.linuxgccrelease isn't in the path where python script is looking for it:
File "/home/software/rosetta_bin_linux_2021.16.61629_bundle/main/tools/rna_tools/bin/rna_helix.py", line 27, in <module>
I'm trying to predict the structure of an antibody by following this Rosetta Antibody Modelling tutorial: https://meilerlab.org/wp-content/uploads/2022/02/RosettaAntibody_tutorial.pdf
At the 5th step, during the refinement of the model, I find the following error:
I'm following this tutorial to run a protein structure prediction: https://new.rosettacommons.org/demos/latest/tutorials/rosetta_cm/rosetta_cm_tutorial
I was able to model one protein sequence successfully following those steps, but trying for different ones I've been getting this same error:
Hi,
When I run fragment_picker, it gives the message:
ERROR: can't open file: $ROSETTA/tools/fragment_tools/vall.jul19.2011.gz
ERROR:: Exit from: src/protocols/frag_picker/VallProvider.cc line: 17
the detail message as follows: