This historical page is locked! For new posts see Github Discussions.

You are here

FARFAR2 error: [ERROR: Not complementary at positions]

1 post / 0 new
FARFAR2 error: [ERROR: Not complementary at positions]
#1

Any help with the following error from the rna_denovo function? Thank you

ERROR: Not complementary at positions g    4 and a   21
ERROR:: Exit from: src/core/pose/rna/RNA_SecStruct.cc line: 284

[ ERROR ]: Caught exception:


File: src/core/pose/rna/RNA_SecStruct.cc:284
[ ERROR ] UtilityExitException
ERROR: Not complementary at positions g    4 and a   21

====

my fasta file:

cgcgaauuagcgcgcgaauuagcg

 

the secondary structure file:

(((((((..((..))..)))))))

 

 

Post Situation: 
Sat, 2023-11-18 02:39
Eden