You are here

Home

Unsolved

The problem hasn't been solved

Comparing a prediction to the native structure and calculate RMSD for RNA

Submitted by danwolf_33 on Thu, 2023-02-09 09:32
Category: 
Nucleic Acids

Hi all,

I am new to Rosetta and FARFAR2. I have attempted modelling the structure of PDB:1KXK using the following command line:

rna_denovo -sequence gucuaccuaucgggcuaaggagccguaugcgaugaaagucgcacguacgguucuaugcccgggggaaaac -cycles 20000 -nstruct 3 -bps_moves false -minimize_rna true -secstruct ".....(((.((((((...(((((((((((((((....))))))..)))))))))..)))))))))....."

Now I want to compare the obtained structure to the original PDB and to calculate the RMSD. I ran the following:

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - Applications

Applying RMSD constraints using pyrosetta or Rosettascripts

Submitted by chenna on Thu, 2023-02-09 05:37
Category: 
Constraints

Hello all,

I'm interested in applying RMSD constraints to a pose using pyrosetta.

I currenly have a native pose which is deformed manually, such the the backbone RMSD with respect to the native is 1 Angstroms. 

pose.residue(r).set_xyz(a, py.rosetta.numeric.xyzVector_double_t(new_coords[0], new_coords[1], new_coords[2]))

However, when I relax (cartesian), I notice the structure relaxing back to the native, ie the RMSD decreases to ~0 Angstroms.

Post Situation: 
Unsolved
Forums: 
PyRosetta - General

How to add uncommon metal elements into Rosetta and make it recognizable?

Submitted by JasonIsaac on Thu, 2023-02-09 00:08
Category: 
Design

HI everyone, I want to RosettaMatch to introduce a ligand into a scaffold protein, but the ligand contains uncommon metals like Rh, I am afraid Rh is not recognizable like Fe by Rosetta. 

So I want to ask about how to add a new metal element to Rosetta, and how many files should I edit to make sure it's done? As far as I know, maybe I have to edit atom_type_sets and residue_types sets under database/chemical/, but more specifically, I have no idea.

Any suggestions would help!  And thanks for you time and effort.

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - General

Install pyrosetta on Ubuntu

Submitted by Xiao Zhu on Mon, 2023-02-06 07:02
Category: 
Compilation

I recently download the rosetta 2022.46 source code and rosetta 2022.46 ubuntu binanry. Then I'm confused how to install them. I try to unpack the binary file into my home directory, but then it seems nothing has been installed. for examle, "no module called pyrosetta" or "no module called pyrosetta.toolbox" or "init is not defined".

And I also complie the source code using scons , but it seems just create a bin folder contained release in some specific folder, but not installed in the system.

Who can help me to solve this problem?

Post Situation: 
Unsolved
Forums: 
PyRosetta - Build/Install

Score function in protein-protein docking with constrains

Submitted by Zehui Zhou on Mon, 2023-02-06 03:31
Category: 
Scoring

Hi, everyone!

I am performing protein-protein docking with AtomPairConstaint (the experiment shows the distance between two ligands) and I have some questions:

a. Whether the ref2015  or ref2015_cst function considers the ligand (with params file)?

b. If I use ref2015_cst in the docking_protocol, does the score function consider the constraint weight in both low- and high-resolution stages?

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - General

No values for total score while running Rosetta score file.

Submitted by Shweata Maurya on Wed, 2023-02-01 02:05
Category: 
Scoring

I am running the Rosetta version - rosetta.source.release-334.tar.bz2 for designing two proteins but no values are generated for the total score. All the important files regarding this are attached. Please look at it and help me with this. 

Post Situation: 
Unsolved
Forums: 
Rosetta 3 - General

Pages