The problem hasn't been solved
Dear users,
In NCAA tutorial, in order to use molfile_to_params_polymer.py script, we have to update the mol file by adding some additional data at the end of mol file.
Any help with the following error from the rna_denovo function? Thank you
ERROR: Not complementary at positions g 4 and a 21
ERROR:: Exit from: src/core/pose/rna/RNA_SecStruct.cc line: 284
[ ERROR ]: Caught exception:
File: src/core/pose/rna/RNA_SecStruct.cc:284
[ ERROR ] UtilityExitException
ERROR: Not complementary at positions g 4 and a 21
====
my fasta file:
cgcgaauuagcgcgcgaauuagcg
the secondary structure file:
Hi,
Could you please verify my academic email address so that I can access ROSIE via Github?
My institution name: Instituto Politecnico Nacional, ENCB, México.
Institution domain: @alumnos.ipn.mx
Thanks!
Are there currently any demo scripts/usage examples for using proteinmpnn in pyrosetta? I've found the module documentation here:https://graylab.jhu.edu/PyRosetta.documentation/index.html
Dear Rosetta community,
I would kindly ask you about possible reasons of AbInitio Relax failure after application of all filters.
It was decided to do an extensive run of AbRelax application with 'use_filters true' option to generate 1000 constructs (nstruct) in hope, that some of them will pass all filters and will have a nature-like fold structure.
I noticed, that when all 3 filters are applied during the construct trial, the AbRelax application fails with such an error:
Finished Abinitio
Hi all,
I was running the Match application and :
1. I noticed that some outputted PDBs are annotated in the log file as follows (I am using cloudPDB as output format):
Hello!
I'm new at Rosetta and was doing the tutorials for protein-protein docking. I execute the command below with no problems:
What is the best way to install PyRosetta for use with Protein MPNN? I am installing it for myself on an hpc cluster (redhat linux 8) and haven't found much documentation outside of that for the general PyRosetta install.
I'm doing protein-protein docking, in which the C-terminus of one of my protein chains (PDB: 2ew4) was amidated, and when I submitted it to Rosetta and ran docking_protocol.static.linuxgccrelease, I found that the amide was automatically disassembled, how can I make it so that it doesn't happen?
2ew4_ 1.pdb is the structure before docking, 2ew4_ 2.pdb is the structure after docking